Paenibacillus cellulosilyticus: HUB94_18925 Help Entry HUB94_18925       CDS       T07813                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pcel  Paenibacillus cellulosilyticus Pathway pcel00998   Biosynthesis of various antibiotics pcel01100   Metabolic pathways pcel01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pcel00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HUB94_18925    00074 Mycolic acid biosynthesis     HUB94_18925   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HUB94_18925 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  QKS46290 LinkDB All DBs Position complement(3789649..3789882) Genome browser AA seq 77 aa AA seqDB search MSEVLDRVKRIVVDRLGAEESEVTLEASFKDDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgaagtactggatcgcgttaaacgcatcgtcgttgaccgcctcggcgctgaagaa tcagaagttacgctagaagcgagcttcaaggatgacctcggcgcagactcgctcgacgta gttgagctggttatggagctggaagacgagtttgacttggagatttctgatgaagacgca gaaaagatcaccactgtgggagaagtagtaaattacatacaatctcatacgtaa

DBGET integrated database retrieval system