Paenibacillus durus: PDUR_13565 Help Entry PDUR_13565        CDS       T03297                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pdu  Paenibacillus durus Pathway pdu01100   Metabolic pathways pdu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pdu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PDUR_13565    00074 Mycolic acid biosynthesis     PDUR_13565   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PDUR_13565 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ12822 UniProt:  A0A089HNZ8 LinkDB All DBs Position 3029754..3029987 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaagcgcattgtcgtcgaccgcttaggagccgacgaa gccgaagtcacactggaagcgtctttcaaagatgatttgggagctgattctctcgacgtt gtagaattggtgatggaattggaagatgaattcgatatggagatctctgatgaagatgca gagaagattacgaccgtgggtgaagttgtaaactacatacaatctcatacctag

DBGET integrated database retrieval system