Candidatus Pelagibacter giovannonii: E5R92_02525 Help Entry E5R92_02525       CDS       T06537                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism peg  Candidatus Pelagibacter giovannonii Pathway peg01100   Metabolic pathways peg01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:peg00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     E5R92_02525    00074 Mycolic acid biosynthesis     E5R92_02525   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     E5R92_02525 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 MCM_C Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  QIZ20660 UniProt:  A0A6H1Q2C8 LinkDB All DBs Position complement(446858..447097) Genome browser AA seq 79 aa AA seqDB search MSEDISSKVKKIVADHLGIDEAKVLDDSSFIDDLGADSLDTVELVMAFEEEFGSEISDSE AEKILTVGDAVNFIAGKAN NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgtcagaagatatttcaagcaaagttaaaaaaattgtagcagatcacttaggtattgat gaagctaaagtattagacgattcaagcttcatagatgaccttggagcagatagtttagat acagttgagttagtaatggcttttgaagaggaatttggttcagaaatttcagatagtgaa gctgaaaaaattcttactgtaggtgacgctgttaactttatagcaggcaaagcaaattag

DBGET integrated database retrieval system