Paenibacillus sp. E222: HW560_27165 Help Entry HW560_27165       CDS       T10443                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pezz  Paenibacillus sp. E222 Pathway pezz00998   Biosynthesis of various antibiotics pezz01100   Metabolic pathways pezz01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pezz00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HW560_27165 (acpP)    00074 Mycolic acid biosynthesis     HW560_27165 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HW560_27165 (acpP) BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  QLG41436 LinkDB All DBs Position complement(6124210..6124443) Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcatcgtcgtcgaccgcttgggcgcagacgaa gctgaagttacacttgaagcatctttcaaagaagatttgggtgctgattctttggatgta gtggaattggtcatggaattggaagatgaattcgatttggaaatctctgatgaagatgca gaaaaaattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system