Planococcus faecalis: AJGP001_11430 Help Entry AJGP001_11430     CDS       T04955                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pfae  Planococcus faecalis Pathway pfae01100   Metabolic pathways pfae01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pfae00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AJGP001_11430    00074 Mycolic acid biosynthesis     AJGP001_11430   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AJGP001_11430 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Motif Other DBs NCBI-ProteinID:  AQU79842 LinkDB All DBs Position complement(2252851..2253087) Genome browser AA seq 78 aa AA seqDB search MSTVLDRVTKVIVDRLGVEENEVKLEASFTGDLGADSLDVVELVMELEDEFDMEISDEDA ENMNTVGDAVTYIEKKQA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt ttgtcaacagtattagatagagtaacgaaagtaatcgtggatcgtctaggtgtagaagag aacgaagtgaaacttgaagcttcattcacaggtgacctaggtgcagattcattggacgta gtagaacttgttatggaacttgaagatgagttcgatatggagatttctgacgaagacgct gaaaacatgaacacagtaggcgacgcagtaacgtatatcgagaaaaaacaagcgtaa

DBGET integrated database retrieval system