Pyrolobus fumarii: Pyrfu_0736 Help Entry Pyrfu_0736        CDS       T01620                                  Name (GenBank) Ribosomal protein L40e   KO K02927   ubiquitin-large subunit ribosomal protein L40e Organism pfm  Pyrolobus fumarii Pathway pfm03010   Ribosome Brite KEGG Orthology (KO) [BR:pfm00001]  09120 Genetic Information Processing   09122 Translation    03010 Ribosome     Pyrfu_0736   09123 Folding, sorting and degradation    04120 Ubiquitin mediated proteolysis     Pyrfu_0736  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03011 Ribosome [BR:pfm03011]     Pyrfu_0736    04121 Ubiquitin system [BR:pfm04121]     Pyrfu_0736 Ribosome [BR:pfm03011]  Ribosomal proteins   Eukaryotes    Large subunit     Pyrfu_0736   Archaea     Pyrfu_0736 Ubiquitin system [BR:pfm04121]  Ubiquitins and ubiquitin-like proteins   Ubiquitins    Pyrfu_0736 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Ribosomal_L40e DUF7577 Zn_Ribbon_1 Zn_ribbon_RanBP DZR HypA Zf_1st_IFT121 Zn_ribbon_3 DHHC Motif Other DBs NCBI-ProteinID:  AEM38605 UniProt:  G0EDC0 LinkDB All DBs Position 681650..681832 Genome browser AA seq 60 aa AA seqDB search MVGIEMPVTDPVKVAIVRKRVLEKLVCRKCGALNPPGATKCRRCKSKNLRPKHAERGMKK NT seq 183 nt NT seq  +upstreamnt  +downstreamnt atggtggggatagagatgccggtcacggaccccgtgaaggttgcgatagtccgtaagcgt gtcttggagaagcttgtgtgcaggaagtgtggtgctcttaacccgccgggcgcgaccaag tgccgcaggtgtaaaagcaagaaccttaggcccaagcacgccgagcgtggtatgaagaag tga

DBGET integrated database retrieval system