Pseudomonas fluorescens UK4: HZ99_11760 Help Entry HZ99_11760        CDS       T03319                                  Name (GenBank) dipicolinate synthase   KO K03530   DNA-binding protein HU-beta Organism pfn  Pseudomonas fluorescens UK4 Brite KEGG Orthology (KO) [BR:pfn00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pfn03032]     HZ99_11760    03036 Chromosome and associated proteins [BR:pfn03036]     HZ99_11760    03400 DNA repair and recombination proteins [BR:pfn03400]     HZ99_11760 DNA replication proteins [BR:pfn03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     HZ99_11760 Chromosome and associated proteins [BR:pfn03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     HZ99_11760 DNA repair and recombination proteins [BR:pfn03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       HZ99_11760 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 SSPI Motif Other DBs NCBI-ProteinID:  AIG02804 UniProt:  A0A379JCN2 LinkDB All DBs Position complement(2612733..2613014) Genome browser AA seq 93 aa AA seqDB search MALTKDQLIADIAESTDTTKVQVRAVLEQLAQIVGDQLDNGGEITLPGVGKLKVTERPAR TGRNPSTGAAIEIAAKKVIKLVVAKGLTDSINK NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atggctttgactaaagaccaactgatcgctgatatcgccgaatccactgataccaccaag gttcaagtacgtgcagtactggagcaactggctcagatcgttggtgaccagctggacaac ggtggcgaaatcactctgccaggtgttggcaaactgaaagtgaccgagcgcccagcccgt accggccgcaacccttcgactggcgctgccatcgaaatcgctgccaagaaagtgatcaag ctggttgtggccaaaggcctgaccgactcgatcaacaagtaa

DBGET integrated database retrieval system