Peribacillus frigoritolerans: L8956_08240 Help Entry L8956_08240       CDS       T08180                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pfri  Peribacillus frigoritolerans Pathway pfri00998   Biosynthesis of various antibiotics pfri01100   Metabolic pathways pfri01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pfri00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     L8956_08240    00074 Mycolic acid biosynthesis     L8956_08240   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     L8956_08240 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  ULM98662 LinkDB All DBs Position 1703566..1703799 Genome browser AA seq 77 aa AA seqDB search MADVLERVTKIVVDRLNVEESEVKLEASFKEDLGADSLDVVELVMEFEDEFDMEISDDDA EKIATVGDAVNYIQSTM NT seq 234 nt NT seq  +upstreamnt  +downstreamnt ttggcagatgtattagaaagagtaactaaaatcgttgtagatcgtttgaacgtagaagaa tcagaggtaaaacttgaagcttctttcaaagaagatcttggtgccgattcccttgatgta gttgaactagtcatggaattcgaagacgagtttgatatggaaatttcggacgatgacgct gaaaaaatcgccacagtaggtgatgctgtgaattacatacaaagcactatgtaa

DBGET integrated database retrieval system