Phaeobacter inhibens DSM 17395: PGA1_c06000 Help Entry PGA1_c06000       CDS       T02192                                  Name (GenBank) chorismate mutase-like protein   KO K04782   isochorismate pyruvate lyase [EC:4.2.99.21] Organism pga  Phaeobacter inhibens DSM 17395 Pathway pga01053   Biosynthesis of siderophore group nonribosomal peptides pga01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pga00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01053 Biosynthesis of siderophore group nonribosomal peptides     PGA1_c06000 Enzymes [BR:pga01000]  4. Lyases   4.2  Carbon-oxygen lyases    4.2.99  Other carbon-oxygen lyases     4.2.99.21  isochorismate lyase      PGA1_c06000 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Mre11_C Motif Other DBs NCBI-ProteinID:  AFO90330 LinkDB All DBs Position 614274..614579 Genome browser AA seq 101 aa AA seqDB search MTDRHPPQDCADMPALRQQIDRLDRDLIALLVERAGYIDRAIALKTANNWPARIPARVEE VVANARTTASAAGLDPDLVESLWRQLVEWSIAREARVIREE NT seq 306 nt NT seq  +upstreamnt  +downstreamnt atgactgaccgacacccgccacaagactgtgctgatatgccagcactgcggcagcagatc gacaggctggaccgggatctgattgcgctgctggtcgaacgggcgggctatatcgaccgc gcgattgcgctgaagacggccaacaactggcccgcgcgcattccggcccgcgtcgaagag gtggttgcaaatgcccggaccacggccagcgctgcggggctagaccccgatctggtcgag agcctgtggcgccagctggtagaatggtcgattgcccgtgaggcacgggtgatccgcgag gagtaa

DBGET integrated database retrieval system