Paenibacillus graminis: PGRAT_05915 Help Entry PGRAT_05915       CDS       T03325                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism pgm  Paenibacillus graminis Pathway pgm03060   Protein export pgm03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:pgm00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     PGRAT_05915  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     PGRAT_05915  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:pgm02044]     PGRAT_05915 Secretion system [BR:pgm02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    PGRAT_05915 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  AIQ67222 UniProt:  A0A089M1Y8 LinkDB All DBs Position 1332001..1332243 Genome browser AA seq 80 aa AA seqDB search MLSGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIINDPEPAKKSEAP AAAAPQTMAADLPQDRRLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctaagcggtattggtgctcccggaataattttgttggtcatcctggcgctgctgctc tttggtcccaataagcttcctgaactgggccgtgcagtcgggcgtacattccgtgaattt aaggacggggcgcgggagattatcaatgacccggaacccgctaaaaaaagcgaagctccg gcagcggcagccccgcagactatggcagcggatcttccgcaggacagacgtctgccggaa taa

DBGET integrated database retrieval system