Pseudothermotoga hypogea: AJ81_07865 Help Entry AJ81_07865        CDS       T04277                                  Name (GenBank) anti-sigma-28 factor FlgM   KO K02398   negative regulator of flagellin synthesis FlgM Organism phy  Pseudothermotoga hypogea Pathway phy02020   Two-component system phy02040   Flagellar assembly Brite KEGG Orthology (KO) [BR:phy00001]  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     AJ81_07865  09140 Cellular Processes   09142 Cell motility    02040 Flagellar assembly     AJ81_07865  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02035 Bacterial motility proteins [BR:phy02035]     AJ81_07865 Bacterial motility proteins [BR:phy02035]  Flagellar system   Flagellar assembly proteins    Others     AJ81_07865 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FlgM Motif Other DBs NCBI-ProteinID:  AJC74104 UniProt:  A0A0X1KSE0 LinkDB All DBs Position 1575913..1576173 Genome browser AA seq 86 aa AA seqDB search MQEINGVGRPFQIQQPAPPEKTERKPRTEGESLNVGEKTNIVELLKEAKETPEVREKLVE QLKIAIEQGTYTIDPGRIAKHIMRQL NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgcaggagatcaatggcgtcggaaggccgtttcagattcagcaaccagcccctccggag aagaccgagagaaagccccgcaccgaaggcgagtctttgaacgttggggagaaaacgaac atagtcgagctgctgaaagaagcgaaggaaactccagaagtacgtgaaaaactcgtagaa cagctcaaaatcgcgatagaacaaggcacctacacgatcgatccggggaggatagcaaag cacataatgaggcagttgtga

DBGET integrated database retrieval system