Paenibacillus ihbetae: BBD41_24275 Help Entry BBD41_24275       CDS       T05154                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pib  Paenibacillus ihbetae Pathway pib00998   Biosynthesis of various antibiotics pib01100   Metabolic pathways pib01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pib00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BBD41_24275    00074 Mycolic acid biosynthesis     BBD41_24275   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BBD41_24275 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  ANY75435 UniProt:  A0A1B2E630 LinkDB All DBs Position 5449758..5449991 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGVDEADVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggaacgcgtgaaacgcatcgttgtcgaccgcctgggtgttgacgaa gccgacgtgacactagaagcatctttcaaagatgaccttggagctgattctctcgatgta gtggaattggtgatggaattggaagatgagtttgatatggagatctctgatgaagatgcg gagaaaattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system