Polynucleobacter ibericus: AOC20_00880 Help Entry AOC20_00880       CDS       T09789                                  Symbol ftsL Name (GenBank) cell division protein FtsL   KO K03586   cell division protein FtsL Organism piu  Polynucleobacter ibericus Brite KEGG Orthology (KO) [BR:piu00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:piu03036]     AOC20_00880 (ftsL) Chromosome and associated proteins [BR:piu03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     AOC20_00880 (ftsL) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FtsL MHC2-interact Motif Other DBs NCBI-ProteinID:  QWE08809 LinkDB All DBs Position 154677..154943 Genome browser AA seq 88 aa AA seqDB search MNRATLTLLALLLICALSLVAAQQRARKLFILQERAQIEERKLNQEWLRLEYEQRNLSKS ARIRDVARNQLRMSPISPERTLYLREAK NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atgaatcgagccactttaactctgctcgcattgctattaatttgcgctttatctctggtc gcagcgcagcaacgtgcacgtaagctgtttattcttcaagagcgtgctcagattgaagag cgtaagttaaatcaagaatggttacgtttagagtacgagcagcgcaatctttctaaatct gcacgcattcgtgatgttgctcgcaatcaattacgtatgtcgccgatttctcctgagcgt actttgtatttgagggaggctaaatga

DBGET integrated database retrieval system