Paenibacillus sp. JDR-2: Pjdr2_3490 Help Entry Pjdr2_3490        CDS       T00977                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pjd  Paenibacillus sp. JDR-2 Pathway pjd00998   Biosynthesis of various antibiotics pjd01100   Metabolic pathways pjd01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pjd00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Pjdr2_3490    00074 Mycolic acid biosynthesis     Pjdr2_3490   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Pjdr2_3490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  ACT02123 LinkDB All DBs Position complement(3967196..3967429) Genome browser AA seq 77 aa AA seqDB search MSEVVERVKRIVVDRLGVDEAEVTLEASFKDDLGADSLDVVELVMELEDEFDLEISDEDA ETITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgaagtagtagaacgtgtaaaacgtatcgtcgtcgacagacttggcgtagacgaa gcggaagtcacgctggaagcttccttcaaagatgacctcggcgctgactctcttgatgtc gttgagttggtcatggaattggaagatgagtttgacctggagatctctgatgaagatgca gagacgatcaccacggtgggagaagtagtcaattacatacaatctcatacgtaa

DBGET integrated database retrieval system