Panthera leo (lion): 122208074 Help Entry 122208074         CDS       T10741                                  Name (RefSeq) metallothionein-1   KO K14739   metallothionein 1/2 Organism plez  Panthera leo (lion) Pathway plez04978   Mineral absorption Brite Messenger RNA biogenesis [BR:plez03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      122208074 Mitochondrial biogenesis [BR:plez03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     122208074 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  122208074 NCBI-ProteinID:  XP_042774632 UniProt:  A0A8C8X0R7 LinkDB All DBs Position E2:33554595..33555510 Genome browser AA seq 61 aa AA seqDB search MDPDCSCATGGSCSCAGSCKCKACRCTSCKKSCCSCCPVGCAKCAQGCICKGASDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatcccgactgctcctgcgccaccggtggctcctgctcgtgcgccggctcctgcaaa tgcaaagcctgcagatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggc tgtgccaagtgtgcccagggctgcatctgcaaaggggcatcggacaagtgcagctgctgc gcctaa

DBGET integrated database retrieval system