Planococcus liqunii: QWY22_12755 Help Entry QWY22_12755       CDS       T10306                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pliq  Planococcus liqunii Pathway pliq01100   Metabolic pathways pliq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pliq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QWY22_12755 (acpP)    00074 Mycolic acid biosynthesis     QWY22_12755 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QWY22_12755 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Motif Other DBs NCBI-ProteinID:  WKA49771 LinkDB All DBs Position complement(2520278..2520514) Genome browser AA seq 78 aa AA seqDB search MATVLERVTKVIVDRLGVEESEVKLEASFTGDLGADSLDVVELVMELEDEFDMEISDEDA EGMATVGDAVTYIEKKQA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt ttggcaacagtattagagcgcgtaactaaagtaatcgtggatcgtctaggtgtggaagaa agcgaagttaaacttgaagcttcattcacaggcgaccttggtgcagattcattagacgta gttgaactggttatggaacttgaagatgaattcgatatggaaatctctgacgaagacgct gaaggtatggcaacagtaggagacgcagtaacatatatcgagaaaaaacaagcgtaa

DBGET integrated database retrieval system