Planococcus versutus: I858_013230 Help Entry I858_013230       CDS       T04421                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pll  Planococcus versutus Pathway pll01100   Metabolic pathways pll01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pll00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     I858_013230    00074 Mycolic acid biosynthesis     I858_013230   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     I858_013230 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Motif Other DBs NCBI-ProteinID:  ANU27950 UniProt:  A0A1B1S430 LinkDB All DBs Position complement(2118594..2118827) Genome browser AA seq 77 aa AA seqDB search MSTVLDRVTKVIVDRLGVEESEVKLEASFTGDLGADSLDVVELVMELEDEFDMEISDEDA ENMNTVGDAVTYIEKKQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt ttgtcaacagtattagatagagtaacgaaagtaatcgtggatcgtctaggagtagaagaa agcgaagtgaaacttgaagcttcatttacaggtgacctaggtgcagattcattggacgta gtagaacttgttatggaacttgaagatgagttcgatatggaaatttctgatgaagacgct gaaaacatgaacacagtaggcgacgcagtaacgtacatcgaaaagaaacaataa

DBGET integrated database retrieval system