Planococcus sp. PAMC 21323: Plano_1920 Help Entry Plano_1920        CDS       T03510                                  Name (GenBank) Acyl carrier protein (ACP)   KO K02078   acyl carrier protein Organism pln  Planococcus sp. PAMC 21323 Pathway pln01100   Metabolic pathways pln01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pln00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Plano_1920    00074 Mycolic acid biosynthesis     Plano_1920   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Plano_1920 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Motif Other DBs NCBI-ProteinID:  AIY05885 UniProt:  A0A0B4RD42 LinkDB All DBs Position complement(1938401..1938634) Genome browser AA seq 77 aa AA seqDB search MSTVLDRVTKVIVDRLGVEESEVKLEASFTGDLGADSLDVVELVMELEDEFDMEISDEDA ENMTTVGDAVTYIEKKQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt ttgtcaacagtattagatagagtaactaaagtaatcgtggatcgtctaggtgtagaagaa agcgaagtgaaacttgaggcttctttcacaggtgacctaggtgcagattcattggacgta gtagaacttgttatggaacttgaagatgagttcgatatggagatttctgacgaggacgct gaaaacatgacgacagtaggcgacgcagtaacgtatatcgaaaagaaacaataa

DBGET integrated database retrieval system