Paenibacillus lautus: D5F53_09045 Help Entry D5F53_09045       CDS       T05701                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism plw  Paenibacillus lautus Pathway plw01100   Metabolic pathways plw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:plw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     D5F53_09045    00074 Mycolic acid biosynthesis     D5F53_09045   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     D5F53_09045 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  AYB43419 UniProt:  A0A1R1AVL9 LinkDB All DBs Position 1908971..1909204 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGVDEADVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggaacgcgtgaaacgcatcgttatcgaccgcctgggtgttgacgaa gccgacgtaacattagaagcatctttcaaagacgaccttggagctgattctctcgatgta gttgaattggtgatggagttggaagatgagtttgatatggagatctctgatgaagatgcg gagaaaattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system