Paenibacillus macerans: LMZ02_23790 Help Entry LMZ02_23790       CDS       T09394                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pmae  Paenibacillus macerans Pathway pmae00998   Biosynthesis of various antibiotics pmae01100   Metabolic pathways pmae01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pmae00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LMZ02_23790 (acpP)    00074 Mycolic acid biosynthesis     LMZ02_23790 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LMZ02_23790 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  UMV46471 LinkDB All DBs Position complement(5415548..5415781) Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggaacgcgtaaaacgcattgtagtggatcgcctcggcgctgacgaa gccgaagtgacgctggaagcgtctttcaaagatgaccttggtgctgattcgctcgacgta gttgaattggtcatggagttggaagatgaattcgatctggaaatttcagacgaagatgct gagaagattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system