Pseudoxanthomonas mexicana: H4W19_10250 Help Entry H4W19_10250       CDS       T06805                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism pmex  Pseudoxanthomonas mexicana Brite KEGG Orthology (KO) [BR:pmex00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:pmex03036]     H4W19_10250 Chromosome and associated proteins [BR:pmex03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     H4W19_10250 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB COG6_N Taxilin bZIP_1 FAZ1_C Herpes_BLRF2 YabA TSC22 GAS FlgN SKA2 Laminin_I Wtap bZIP_2 Shugoshin_N DUF7491 Mod_r COG3_N DUF3450 KfrA_N DUF7603 DUF2203 Nup88 DASH_Dam1 TMPIT JIP_LZII Spc24 Motif Other DBs NCBI-ProteinID:  QND78780 LinkDB All DBs Position 2162248..2162469 Genome browser AA seq 73 aa AA seqDB search MDNADLLDQLRTLGTRIQDLADRCQRLADENRSLRQQQEHLVGERSQLLAKNEQARSRVE AMISRLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggataacgccgaccttctcgaccagctccgcacgctcggtacgcgcatccaggacctg gcggaccgttgccagcgcctggcggacgagaaccgaagcctgcgccagcagcaggagcac ctggtcggtgaacgctcgcagctgctggccaagaacgaacaggcgcgctcgcgcgtggaa gcgatgatcagccgcctgaagtcgctggagcagcacacatga

DBGET integrated database retrieval system