Petrotoga mobilis: Pmob_1011 Help Entry Pmob_1011         CDS       T00621                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pmo  Petrotoga mobilis Pathway pmo01100   Metabolic pathways pmo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pmo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Pmob_1011    00074 Mycolic acid biosynthesis     Pmob_1011   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Pmob_1011 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 Ribosomal_L50 DUF1493 ANTAR Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  ABX31733 UniProt:  A9BJZ0 LinkDB All DBs Position 1078867..1079124 Genome browser AA seq 85 aa AA seqDB search MTKDELFEKVKEIIVDTLSVDEDEVTLDASFTDDLDADSLELVDLTMAFESEFGVTIEDE ELEKIKTVENAVNLLSEKLNIDDED NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgacaaaggatgagttgttcgaaaaagtaaaagaaataatcgtagatacattgagtgtc gacgaggatgaagttacattggatgcctcatttaccgatgatttagacgcggattcttta gagctagtagatttgaccatggcttttgagtctgaattcggagtaacgatagaggatgaa gagttagaaaaaatcaaaaccgttgaaaatgcggttaatttattatctgaaaaattgaac atcgacgatgaggattga

DBGET integrated database retrieval system