Paenibacillus mucilaginosus K02: B2K_26890 Help Entry B2K_26890         CDS       T02041                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pmw  Paenibacillus mucilaginosus K02 Pathway pmw00998   Biosynthesis of various antibiotics pmw01100   Metabolic pathways pmw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pmw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     B2K_26890    00074 Mycolic acid biosynthesis     B2K_26890   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     B2K_26890 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AFH64274 UniProt:  I0BPH7 LinkDB All DBs Position complement(6395849..6396082) Genome browser AA seq 77 aa AA seqDB search MSDILDRVKKIVVDRLGVDEAEVTLEANFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGQVVEYIKSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatattttggatcgcgttaaaaaaatcgtcgtcgaccgactcggagtggatgag gcggaagtgacgcttgaagctaatttcaaggatgaccttggtgccgattctctcgatgta gtagaattggttatggagttggaagatgagtttgatatggaaatctctgatgaagatgca gagaagatcgctactgtaggtcaagtagtggagtacataaaatctcatacctaa

DBGET integrated database retrieval system