Pseudomonas aeruginosa NCGM2.S1: NCGM2_2787 Help Entry NCGM2_2787        CDS       T01974                                  Name (GenBank) putative acyl carrier protein   KO K02078   acyl carrier protein Organism pnc  Pseudomonas aeruginosa NCGM2.S1 Pathway pnc01100   Metabolic pathways pnc01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pnc00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     NCGM2_2787    00074 Mycolic acid biosynthesis     NCGM2_2787   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     NCGM2_2787 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 DUF7080 Motif Other DBs NCBI-ProteinID:  BAK89639 LinkDB All DBs Position 1:2964954..2965193 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARLGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaagctggtagccgcccggctcggcgtggaggaa tgcgacatccggctggacagcgatttccgtaacgacttcggtgccgagtcgctcgaggtg gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system