Paenibacillus naphthalenovorans: IJ22_12170 Help Entry IJ22_12170        CDS       T04167                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pnp  Paenibacillus naphthalenovorans Pathway pnp00998   Biosynthesis of various antibiotics pnp01100   Metabolic pathways pnp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pnp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     IJ22_12170    00074 Mycolic acid biosynthesis     IJ22_12170   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     IJ22_12170 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ALS21593 UniProt:  A0A0U2U584 LinkDB All DBs Position 1231609..1231842 Genome browser AA seq 77 aa AA seqDB search MSDVLDRVKRIVVDRLGVDEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGQVVEYIKSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggatcgtgtaaaacgtatcgtcgttgaccgtcttggtgtggatgag gcggaagtgacgcttgaagcatcttttaaagatgatttgggtgccgattctctcgatgtc gtagaattggttatggaattggaagatgagtttgatatggaaatctctgatgaggatgca gagaaaattactactgtaggtcaagtagttgagtacataaaatctcatacttaa

DBGET integrated database retrieval system