Paenibacillus odorifer: PODO_11640 Help Entry PODO_11640        CDS       T03326                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism pod  Paenibacillus odorifer Pathway pod00998   Biosynthesis of various antibiotics pod01100   Metabolic pathways pod01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pod00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PODO_11640    00074 Mycolic acid biosynthesis     PODO_11640   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PODO_11640 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Peptidase_C42 Motif Other DBs NCBI-ProteinID:  AIQ73847 UniProt:  A0A1R0X6E4 LinkDB All DBs Position 2680493..2680750 Genome browser AA seq 85 aa AA seqDB search MDQIQQRVEVLLRLFVKCDISLEPESVFTDLEMDSLTYIKFIVEVERALQLDFDPYLLVA GHFPTVGDLTAYLWSKNGEGCATDA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atggaccaaatacaacagcgggtggaggtattgctgcgcctatttgtaaagtgtgatatt tccttggagcccgaaagtgtgttcacagatctggaaatggattcgcttacttacatcaaa tttattgttgaagttgagcgggcgttgcaattggactttgatccttaccttttggtagca ggacattttcctacggttggagatttaacggcatatctctggagtaaaaatggtgaagga tgtgccacagatgcctaa

DBGET integrated database retrieval system