Paenibacillus odorifer: PODO_13440 Help Entry PODO_13440        CDS       T03326                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pod  Paenibacillus odorifer Pathway pod00998   Biosynthesis of various antibiotics pod01100   Metabolic pathways pod01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pod00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PODO_13440    00074 Mycolic acid biosynthesis     PODO_13440   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PODO_13440 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ74170 UniProt:  A0A1R0XFY6 LinkDB All DBs Position 3031589..3031822 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ETITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattagagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagacgattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system