Polaromonas sp. Pch-P: F7R28_11600 Help Entry F7R28_11600       CDS       T06273                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism poo  Polaromonas sp. Pch-P Brite KEGG Orthology (KO) [BR:poo00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:poo03036]     F7R28_11600 (zapB) Chromosome and associated proteins [BR:poo03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     F7R28_11600 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Crescentin DUF4164 Taxilin Cep57_CLD_2 HMMR_C DivIC CENP-F_leu_zip Baculo_PEP_C DUF3450 DivIVA DNA_pol3_delta_C YabA TPR_MLP1_2 bZIP_1 HalX Motif Other DBs NCBI-ProteinID:  QGJ18974 UniProt:  A0A5Q3HEH5 LinkDB All DBs Position complement(2466883..2467119) Genome browser AA seq 78 aa AA seqDB search MANQTQIDQIVERVERLLLRYEELQRTNALLTEQVNVLTQERDSLKSRLGAARARVDALL ERLPESNGHTKTTVGTES NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggcgaaccaaacccaaatcgaccagatcgtcgaacgcgttgagcggcttttgctgcgc tacgaagagctgcagcgcaccaacgcgctgctgacagagcaggtcaacgttttgacacag gaacgcgactcgctcaagtcgcgcctgggtgccgcgcgcgcgcgcgtggatgcgctcctg gagcgcctgcctgaaagcaatggccacaccaaaaccaccgtgggaaccgagtcatga

DBGET integrated database retrieval system