Pseudomonas paraeruginosa: B7D75_15605 Help Entry B7D75_15605       CDS       T08722                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ppaa  Pseudomonas paraeruginosa Pathway ppaa01100   Metabolic pathways ppaa01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppaa00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     B7D75_15605 (acpP)    00074 Mycolic acid biosynthesis     B7D75_15605 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     B7D75_15605 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF1493 Ribosomal_L12_N DUF7080 Hera_DD PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  AVR68301 UniProt:  A0A2R3IZV0 LinkDB All DBs Position complement(3306252..3306491) Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARLGVEECDIRLDSDFRRDFGAESLEVVELVMALEAEFGVEIADDDV ERIETVREAVDYLEEAVPS NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtggccgcccggctcggcgtggaggaa tgcgacatccggctcgacagcgactttcgtcgcgacttcggagccgagtcgctcgaggtg gtcgagctggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgacgtg gagcggatcgagaccgtgcgcgaggccgtcgactacctcgaggaagccgtccctagctga

DBGET integrated database retrieval system