Paenibacillus pabuli: KET34_12425 Help Entry KET34_12425       CDS       T09669                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ppab  Paenibacillus pabuli Pathway ppab00998   Biosynthesis of various antibiotics ppab01100   Metabolic pathways ppab01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppab00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KET34_12425 (acpP)    00074 Mycolic acid biosynthesis     KET34_12425 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KET34_12425 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  UPK46186 LinkDB All DBs Position 2679017..2679250 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcatcgtcgtcgaccgcttgggcgcagacgaa gctgaagttacacttgaagcatctttcaaagaagatttaggtgctgattctttggatgta gtggaattggtcatggaattggaagatgaattcgatttggaaatctctgatgaagatgca gaaaaaattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system