Palaeococcus pacificus: PAP_06900 Help Entry PAP_06900         CDS       T03210                                  Name (GenBank) histone   KO K24450   DNA-binding protein Organism ppac  Palaeococcus pacificus Brite KEGG Orthology (KO) [BR:ppac00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ppac03036]     PAP_06900 Chromosome and associated proteins [BR:ppac03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     PAP_06900 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CBFD_NFYB_HMF Histone TAF CENP-S CENP-T_C TFIID-31kDa TFIID-18kDa TFIID_20kDa DUF1931 Bromo_TP DUF6417 Motif Other DBs NCBI-ProteinID:  AIF69774 UniProt:  A0A075LTS7 LinkDB All DBs Position 1240705..1240908 Genome browser AA seq 67 aa AA seqDB search MAELPIAPVDRLIRKAGAPRVSEEAAKVLAEHLEDKAMEIAKKAVELAHHAGRKTVKAED IKLAIKQ NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atggctgagttgccaattgccccagttgacagattgattagaaaggcaggtgctccaaga gttagtgaggaggccgccaaggttctcgccgagcaccttgaggacaaggctatggaaatc gctaagaaggctgtcgagcttgcccaccacgcaggcaggaagacagtcaaggccgaggac attaagttggccattaagcaatga

DBGET integrated database retrieval system