Paenibacillus peoriae: ABE82_06225 Help Entry ABE82_06225       CDS       T04053                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism ppeo  Paenibacillus peoriae Pathway ppeo03060   Protein export ppeo03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:ppeo00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     ABE82_06225  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     ABE82_06225  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:ppeo02044]     ABE82_06225 Secretion system [BR:ppeo02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    ABE82_06225 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E DUF4834 Motif Other DBs NCBI-ProteinID:  ALA41147 UniProt:  A0A0K2F5V1 LinkDB All DBs Position 1471752..1472003 Genome browser AA seq 83 aa AA seqDB search MPNIGAPGYILLIILALLLFGPNKLPELGRAVGRTFREFKNGARDILSEDERTERKDSKD SVVKASQTTSSEVQPQPEDKRLS NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgcccaatattggagcaccgggttatattttgttgattattctggcgctgctgttattt ggtccgaacaagctgcctgagctgggtcgagctgtagggcgtacattccgtgagtttaaa aacggggcacgcgatattttatcagaagatgaacggactgagcgtaaagacagcaaagat agtgtggtcaaagcatcacaaacgacgtcttcagaagttcaacctcagcctgaggataaa cgcttgtcatag

DBGET integrated database retrieval system