Paenibacillus peoriae: ABE82_09855 Help Entry ABE82_09855       CDS       T04053                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ppeo  Paenibacillus peoriae Pathway ppeo00998   Biosynthesis of various antibiotics ppeo01100   Metabolic pathways ppeo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppeo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ABE82_09855    00074 Mycolic acid biosynthesis     ABE82_09855   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ABE82_09855 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  ALA41805 UniProt:  A0A0K2F831 LinkDB All DBs Position 2211694..2211927 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatcttttaaagatgatttaggcgctgattctctcgatgta gttgaattggtaatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaactgtaggtgaagttgtgaagtacatacaatctcatacctaa

DBGET integrated database retrieval system