Pengzhenrongella phosphoraccumulans: VTA80_03345 Help Entry VTA80_03345       CDS       T10828                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pphp  Pengzhenrongella phosphoraccumulans Pathway pphp01100   Metabolic pathways pphp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pphp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     VTA80_03345    00074 Mycolic acid biosynthesis     VTA80_03345   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     VTA80_03345 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L50 PP-binding_2 Motif Other DBs NCBI-ProteinID:  WVT80980 LinkDB All DBs Position 692723..692971 Genome browser AA seq 82 aa AA seqDB search MANTEQEILAGLAEIVSEETGLPTDSVLPEKSFTDDLDIDSLSMMTIVTLAEEKFGVRIP DDEVKNLSSVGDVIKFIQGAQA NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggcgaacaccgagcaggagatcctggccggactggccgagatcgtcagcgaggagacc ggtcttcccaccgactccgtcctgcccgagaagtccttcaccgacgacctcgacatcgac tcgctgtcgatgatgacgatcgtcacgctcgccgaggagaagttcggcgtacgcattccc gacgacgaggtcaagaacctctcgagcgtcggcgatgtcatcaagttcatccagggcgcg caggcgtag

DBGET integrated database retrieval system