Pseudomonas plecoglossicida: RK21_04706 Help Entry RK21_04706        CDS       T03646                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism ppj  Pseudomonas plecoglossicida Brite KEGG Orthology (KO) [BR:ppj00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ppj03036]     RK21_04706 Chromosome and associated proteins [BR:ppj03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     RK21_04706 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  DivIVA ZapB Phlebovirus_NSM Mod_r bZIP_2 HAP1_N ERM_C CCDC22_CC bZIP_1 Ax_dynein_light YabA ATG16 ADIP PUMA_CC Herpes_UL6 Macoilin DUF1902 Rootletin Spectrin_3 Sos7 DUF4407 Motif Other DBs NCBI-ProteinID:  AJG16214 UniProt:  A0A099N7I4 LinkDB All DBs Position complement(4932756..4932986) Genome browser AA seq 76 aa AA seqDB search MLEASLNQIEQLVSDLMQKNAQLTEQNAALGQELAQAKEENETLQLSLMEQEEKNGSTAA RLQALLERANAGVVGA NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atgctggaagcttccctgaatcaaatcgagcaactggtcagcgacctgatgcagaagaac gctcaactcaccgagcagaacgccgccctcggtcaggaactggcccaggccaaggaagag aacgaaaccctgcagctgtcgctgatggagcaggaagagaagaacggcagcaccgccgca cgcctgcaggccctgctcgagcgcgccaacgccggcgtcgtaggcgcatga

DBGET integrated database retrieval system