Paenibacillus polymyxa SC2: PPSC2_09680 Help Entry PPSC2_09680       CDS       T01335                                  Symbol acpA Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ppm  Paenibacillus polymyxa SC2 Pathway ppm00998   Biosynthesis of various antibiotics ppm01100   Metabolic pathways ppm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PPSC2_09680 (acpA)    00074 Mycolic acid biosynthesis     PPSC2_09680 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PPSC2_09680 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  ADO56024 UniProt:  E3EFZ1 LinkDB All DBs Position 2129908..2130141 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatcttttaaagatgatttaggcgctgattctctcgatgta gttgaattggttatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaactgtaggtgaagttgtgaagtacatacaatctcatacctaa

DBGET integrated database retrieval system