Paenibacillus polymyxa M1: PPM_1848 Help Entry PPM_1848          CDS       T01968                                  Symbol acpA Name (GenBank) acyl carrier protein ACP   KO K02078   acyl carrier protein Organism ppo  Paenibacillus polymyxa M1 Pathway ppo00998   Biosynthesis of various antibiotics ppo01100   Metabolic pathways ppo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PPM_1848 (acpA)    00074 Mycolic acid biosynthesis     PPM_1848 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PPM_1848 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  CCC84785 LinkDB All DBs Position 2130023..2130256 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatcttttaaagatgatttaggcgctgattctctcgatgta gttgaattggttatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaactgtaggtgaagttgtgaagtacatacaatctcatacctaa

DBGET integrated database retrieval system