Pongo pygmaeus (Bornean orangutan): 129015324 Help Entry 129015324         CDS       T10128                                  Name (RefSeq) metallothionein-1E-like   KO K14739   metallothionein 1/2 Organism ppyg  Pongo pygmaeus (Bornean orangutan) Pathway ppyg04978   Mineral absorption Brite Messenger RNA biogenesis [BR:ppyg03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      129015324 Mitochondrial biogenesis [BR:ppyg03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     129015324 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  129015324 NCBI-ProteinID:  XP_054309042 LinkDB All DBs Position 18:53768880..53770222 Genome browser AA seq 61 aa AA seqDB search MDPNCSCTTGVSCACAGSCKCKECKCTSCKKSCCSCCPVGCAKCAQGCVCKGASEKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgcaccactggtgtctcctgcgcctgcgccggctcctgcaag tgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggc tgtgccaagtgtgcccagggctgcgtctgcaaaggggcgtcggagaagtgcagctgctgt gcctga

DBGET integrated database retrieval system