Pongo pygmaeus (Bornean orangutan): 129044110 Help Entry 129044110         CDS       T10128                                  Name (RefSeq) metallothionein-1B-like   KO K14739   metallothionein 1/2 Organism ppyg  Pongo pygmaeus (Bornean orangutan) Pathway ppyg04978   Mineral absorption Brite Messenger RNA biogenesis [BR:ppyg03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      129044110 Mitochondrial biogenesis [BR:ppyg03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     129044110 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  129044110 NCBI-ProteinID:  XP_054357719 LinkDB All DBs Position 13:complement(85864526..85864724) Genome browser AA seq 60 aa AA seqDB search MDPNGSCTTGGSCACAGSCKCKECRCTSCKKICSCCPVGCAKCAQGCICKGATEKCSCCA NT seq 183 nt NT seq  +upstreamnt  +downstreamnt atggaccccaacggctcctgcaccactggcggctcctgcgcctgtgctggctcctgcaaa tgcaaagagtgcagatgcacctcctgcaagaagatctgctcctgctgccctgtgggctgt gccaagtgtgcccagggctgcatctgcaaaggggcaacagagaagtgcagctgctgtgcc tga

DBGET integrated database retrieval system