Pradoshia sp. D12: F7984_06655 Help Entry F7984_06655       CDS       T06218                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism prd  Pradoshia sp. D12 Pathway prd01100   Metabolic pathways prd01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:prd00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     F7984_06655    00074 Mycolic acid biosynthesis     F7984_06655   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     F7984_06655 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Ribosomal_L50 DUF1493 Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  QFK70948 LinkDB All DBs Position 1349846..1350079 Genome browser AA seq 77 aa AA seqDB search MSDVLEKVSKIIVDRLGVDESEVTLEASFKDDLGADSLDVVELVMELEDEFGMEISDDDA EKISTVGDAVNYIKSQN NT seq 234 nt NT seq  +upstreamnt  +downstreamnt gtgtcagacgtattagagaaagtatctaaaataatcgtagatcgccttggtgtagatgaa tccgaagtaacacttgaagcttcttttaaagatgatcttggtgctgattcccttgatgtt gtggaattggttatggaacttgaagatgaattcggtatggaaatttcagatgatgatgct gaaaaaatttcaacagttggcgatgctgtgaactacataaaaagccaaaactaa

DBGET integrated database retrieval system