Paenibacillus riograndensis: PRIO_1251 Help Entry PRIO_1251         CDS       T03849                                  Name (GenBank) hypothetical protein   KO K03116   sec-independent protein translocase protein TatA Organism pri  Paenibacillus riograndensis Pathway pri03060   Protein export pri03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:pri00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     PRIO_1251  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     PRIO_1251  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:pri02044]     PRIO_1251 Secretion system [BR:pri02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    PRIO_1251 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  CQR53243 UniProt:  A0A0E3WGJ9 LinkDB All DBs Position I:1433042..1433284 Genome browser AA seq 80 aa AA seqDB search MLSGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIINDPEPAKKSEAP AAAAPQTMTADLPQDRRLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctaagtggtattggtgctcccggaattattttgttagtcatcctggcgctgctgctc tttggtcccaataagcttcctgaactgggccgggccgtcgggcgtaccttccgtgaattt aaggacggggcgcgggaaatcatcaatgacccggaacccgctaagaaaagcgaagctccg gcagcggcagccccgcagactatgacagcagatcttccgcaggacagacgtctgccggaa taa

DBGET integrated database retrieval system