Paenibacillus riograndensis: PRIO_3162 Help Entry PRIO_3162         CDS       T03849                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism pri  Paenibacillus riograndensis Pathway pri00998   Biosynthesis of various antibiotics pri01100   Metabolic pathways pri01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pri00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PRIO_3162    00074 Mycolic acid biosynthesis     PRIO_3162   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PRIO_3162 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  CQR55565 UniProt:  A0A0E4HDR5 LinkDB All DBs Position I:3737169..3737402 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtcatcgaccgcttaggagccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttgggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagaagattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system