Paenibacillus sp. RUD330: CIC07_06010 Help Entry CIC07_06010       CDS       T11330                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism prud  Paenibacillus sp. RUD330 Pathway prud00998   Biosynthesis of various antibiotics prud01100   Metabolic pathways prud01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:prud00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CIC07_06010 (acpP)    00074 Mycolic acid biosynthesis     CIC07_06010 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CIC07_06010 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  ASS65748 UniProt:  A0AAC9Y933 LinkDB All DBs Position complement(3147026..3147259) Genome browser AA seq 77 aa AA seqDB search MSEVVDRVKRIVVDRLGVDEAEVTLEASFKDDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgaagtagtggatcgcgtcaaacgcatcgtagtggatcgtcttggcgtagacgag gcggaagttaccctcgaagcttctttcaaggatgacctcggcgctgactcgttagacgtc gttgaactcgtcatggagcttgaagatgaattcgacctggaaatctctgatgaagatgcg gagaagatcacgacggtgggagaagtagtcaattacatacaatctcatacgtaa

DBGET integrated database retrieval system