Polymorphospora rubra: Prubr_72430 Help Entry Prubr_72430       CDS       T07190                                  Name (GenBank) hypothetical protein   KO K01821   4-oxalocrotonate tautomerase [EC:5.3.2.6] Organism pry  Polymorphospora rubra Pathway pry00362   Benzoate degradation pry00621   Dioxin degradation pry00622   Xylene degradation pry01100   Metabolic pathways pry01120   Microbial metabolism in diverse environments pry01220   Degradation of aromatic compounds Module pry_M00569   Catechol meta-cleavage, catechol => acetyl-CoA / 4-methylcatechol => propanoyl-CoA Brite KEGG Orthology (KO) [BR:pry00001]  09100 Metabolism   09111 Xenobiotics biodegradation and metabolism    00362 Benzoate degradation     Prubr_72430    00622 Xylene degradation     Prubr_72430    00621 Dioxin degradation     Prubr_72430 Enzymes [BR:pry01000]  5. Isomerases   5.3  Intramolecular oxidoreductases    5.3.2  Interconverting keto- and enol-groups     5.3.2.6  2-hydroxymuconate tautomerase      Prubr_72430 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Tautomerase Motif Other DBs NCBI-ProteinID:  BCJ70222 UniProt:  A0A810N9A9 LinkDB All DBs Position complement(8102315..8102524) Genome browser AA seq 69 aa AA seqDB search MATIRVELGARDQETREAIIADLTDVMVKYGSPRESTQVILYEISMDLWAKGGIPYSKRA AAARAEGTA NT seq 210 nt NT seq  +upstreamnt  +downstreamnt atggccaccatccgtgtcgagctcggcgcccgtgaccaggagacccgggaggcgatcatc gccgacctgaccgacgtgatggtcaagtacggttcgccgcgcgagagcacccaggtcatc ctgtacgagatctcgatggacctgtgggcgaagggcgggattccctacagcaagcgcgcg gcggcggcgcgggccgaagggacagcatga

DBGET integrated database retrieval system