Pseudomonas aeruginosa B136-33: G655_15790 Help Entry G655_15790        CDS       T02627                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism psg  Pseudomonas aeruginosa B136-33 Pathway psg01100   Metabolic pathways psg01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:psg00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     G655_15790    00074 Mycolic acid biosynthesis     G655_15790   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     G655_15790 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 DUF7080 Motif Other DBs NCBI-ProteinID:  AGI82074 LinkDB All DBs Position complement(3499289..3499528) Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARLGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaagctggtagccgcccggctcggcgtggaggaa tgcgacatccggctggacagcgatttccgtaacgacttcggtgccgagtcgctcgaggtg gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system