Pimelobacter simplex: KR76_22805 Help Entry KR76_22805        CDS       T03528                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism psim  Pimelobacter simplex Pathway psim01100   Metabolic pathways psim01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:psim00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KR76_22805    00074 Mycolic acid biosynthesis     KR76_22805   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KR76_22805 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AIY18900 UniProt:  A0A0A1DU16 LinkDB All DBs Position 4619711..4619968 Genome browser AA seq 85 aa AA seqDB search MNEIEPRIVTIVTELLERSDREETTVSLAATLHGDDGLALDSLETAELSAILEDEFGNDP FGAGLLPETVADIVAFYADATAASA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgaacgagattgagcccaggatcgtcacgatcgtcaccgagctgctggagcgctccgac cgcgaggagacgaccgtctcgctcgccgccaccctgcacggcgacgacggcctcgcgctg gactcgctcgagacggccgagctctcggcgatcctcgaggacgagttcggcaacgacccg ttcggcgcgggcctgctgcccgagacggtggccgacatcgtggcgttctacgccgacgcc accgctgcgtccgcatga

DBGET integrated database retrieval system