Pseudomonas sp. NC02: C0058_05095 Help Entry C0058_05095       CDS       T10251                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism psnc  Pseudomonas sp. NC02 Brite KEGG Orthology (KO) [BR:psnc00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:psnc03032]     C0058_05095    03036 Chromosome and associated proteins [BR:psnc03036]     C0058_05095    03400 DNA repair and recombination proteins [BR:psnc03400]     C0058_05095 DNA replication proteins [BR:psnc03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     C0058_05095 Chromosome and associated proteins [BR:psnc03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     C0058_05095 DNA repair and recombination proteins [BR:psnc03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       C0058_05095 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_euk_2 HU-CCDC81_bac_2 HTH_IclR SSPI Motif Other DBs NCBI-ProteinID:  AUO21386 LinkDB All DBs Position 1118103..1118384 Genome browser AA seq 93 aa AA seqDB search MAITKDQLIADLAEAVDAPKTTVRALLDQLSQIVADQLENGGEITLPGVGKLKVTERPAR TGRNPSTGAAIEIAAKKVIKLVVAKGLTDAVNK NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atggctattactaaagaccaactgatcgctgatctggctgaagctgtagacgcaccgaaa accaccgtgcgtgctctgctggaccaactgagccagatcgttgctgatcagctggaaaac ggcggcgaaatcactctgccaggcgttggcaaactgaaagtgaccgagcgtcctgcccgt actggccgtaacccttcgactggcgctgccatcgaaatcgctgccaagaaagttatcaag ctggttgtggccaaaggcctgaccgacgctgttaacaagtaa

DBGET integrated database retrieval system