Pandoraea sputorum: NA29_02430 Help Entry NA29_02430        CDS       T03554                                  Name (GenBank) hypothetical protein   KO K07122   phospholipid transport system transporter-binding protein Organism pspu  Pandoraea sputorum Pathway pspu02010   ABC transporters Brite KEGG Orthology (KO) [BR:pspu00001]  09130 Environmental Information Processing   09131 Membrane transport    02010 ABC transporters     NA29_02430  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02000 Transporters [BR:pspu02000]     NA29_02430 Transporters [BR:pspu02000]  ABC transporters, prokaryotic type   Saccharide, polyol, and lipid transporters    Phospholipid transporter     NA29_02430 SSDB OrthologParalogGFIT Motif Pfam:  STAS_2 STAS Motif Other DBs NCBI-ProteinID:  AJC15189 UniProt:  A0A239SWV7 LinkDB All DBs Position complement(5311524..5311781) Genome browser AA seq 85 aa AA seqDB search MLALQTDLTHDTAGDVLAQAIDRIDAGETQIDCAGLTHFDSSALAVLLALRRHAGRRGAT LAFTNLPTGLASLALVYGVDHLLSS NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgctcgcgttgcaaaccgacctgactcacgacactgccggcgacgtcctcgcgcaggcc atcgatcgcatcgacgcgggggagacccagatcgactgcgccgggctcacgcatttcgac tcgtcggcgctcgcggtgctgctggccttgcgccgtcacgcgggtcggcgtggtgcgacg ttggcgttcactaacttgccgacagggctggccagtcttgcactggtgtacggcgtcgac catctgctctcgagctga

DBGET integrated database retrieval system