Paenibacillus swuensis: SY83_15850 Help Entry SY83_15850        CDS       T04884                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pswu  Paenibacillus swuensis Pathway pswu00998   Biosynthesis of various antibiotics pswu01100   Metabolic pathways pswu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pswu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SY83_15850    00074 Mycolic acid biosynthesis     SY83_15850   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SY83_15850 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  ANE47509 UniProt:  A0A172TKB5 LinkDB All DBs Position 3576777..3577010 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGVDEAEVTTEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattagagcgtgtaaagcgtatcgttattgatcgtctaggagttgacgag gctgaagttactaccgaagcatctttcaaagatgacttaggcgctgactctctcgacgtt gtagaactggttatggagctagaggacgagttcgatatggaaatttccgatgaggatgct gagaagattactactgtaggagaagttgtgaaatacatacaatctcatacgtaa

DBGET integrated database retrieval system