Psychrobacillus sp. AK 1817: D0S48_05630 Help Entry D0S48_05630       CDS       T06219                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism psyh  Psychrobacillus sp. AK 1817 Pathway psyh01100   Metabolic pathways psyh01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:psyh00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     D0S48_05630    00074 Mycolic acid biosynthesis     D0S48_05630   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     D0S48_05630 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  QEY20204 LinkDB All DBs Position complement(1073915..1074151) Genome browser AA seq 78 aa AA seqDB search MSTVLERVTKVIVDRLGVDESEVKLEASFRDDLGADSLDVVELVMELEDEFDMEISDEDA ENISTVGSAVSYIESKQG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt gtgtcaacagttttagaacgtgtaactaaagttatcgtagatcgtcttggagtagacgaa agcgaagtaaaattagaagcatccttccgtgatgatttaggtgccgactcactagatgta gttgagttagtaatggagcttgaagatgagttcgatatggagatttcggatgaagatgct gagaatatttcaactgtgggtagcgcagttagctatattgaaagcaaacaaggctaa

DBGET integrated database retrieval system